samedi 1 novembre 2025

🫁 MSO - FASTA file NCBI OV986001.1

MSO Base 4 Demonstration: Deterministic Geometric Resolution of FASTA Sequences (NCBI OV986001.1)

​Author: Yannick Fouconnier | August 2026.

MSO Reference: 10.5281/zenodo.19385043

Data Source: NCBI Nucleotide Archive — Accession OV986001.1

  1. ​Input Data (NCBI Raw FASTA File) Extracted genomic sequence from the public NCBI repository:

  2. ​OV986001.1 Genomic Sequence Extract (NCBI Public Repository)

    ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC


    1. ​Step 1: Mapping to the Native Base-4 Vector Alphabet Classical probabilistic bioinformatics treats sequences as ASCII strings subject to variance approximations. The MSO Kernel executes an immediate deterministic vector projection:

    2. ​A (Adenine) → A (00₂)

    3. ​C (Cytosine) → B (01₂)

    4. ​G (Guanine) → C (10₂)

    5. ​T (Thymine) → 0 (11₂)

  3. ​Generated MSO Vectorial Strand:

    [A, 0, C, B, C, A, 0, B, C, A, 0, B, C, A, 0, B, C, A, 0, B, C, A, 0, B, ...]

    1. ​Step 2: Geometric Invariant & Trajectory on the D₂₄ Lattice For a k-mer size of k = 4, sliding cellular windows are directly projected as discrete state coordinates onto the D₂₄ lattice:

    2. ​1st k-mer (ATGC): [A, 0, C, B] → Initial phase coordinate Φ₀.

    3. ​2nd k-mer (TGCA): [0, C, B, A] → Orthogonal geometric translation to the adjacent lattice node.

  4. ​The invariant operator ICN ≈ 1.0418 fixes the exact metric of each state transition without statistical bias.

    1. ​Step 3: Deterministic Isolation (Substitutions vs. Indels)


Biological Event

Classical Probabilistic Model

MSO Base-4 Resolution (V'GER Kernel)

Substitution (T → C)

Probabilistic score penalty (p_sub) & variance drift

Local phase rotation (Δφ) on the D₂₄ lattice node

Insertion / Deletion (Indel)

Gap penalty & combinatorial explosion

Topological shift (Conway path) without metric loss

  1. ​Guarantees & Algorithmic Summary

  • ​Zero Entropy Debt (E_debt = 0): Zero information loss or cumulative noise over length N.

  • ​Linear Time Complexity O(N): Direct linear execution by eliminating heavy covariance matrices and Monte-Carlo simulations.

  • ​Absolute Reproducibility: Deterministic validation applicable to any k-mer analysis pipeline without relying on asymptotic concentration bounds.